# sRNA Target Prediction

In the "sRNA Target Prediction" function, the function of <mark style="color:red;">**small RNA (sRNA) target gene prediction**</mark> is provided. There are two modes:

* Mode 1, the user inputs the sRNA sequence in FASTA format, selects the species to be analyzed, and then predicts all potential target genes in the species;
* Mode 2, the user inputs the gene sequence in FASTA format or directly input the Gene ID, and selects species, the program automatically predicts all potential sRNA targets site for the input sequence.

<figure><img src="/files/LuYTrNRX4hQ1ba73G00B" alt=""><figcaption></figcaption></figure>

### Input file format & Result <a href="#input-file-format--result" id="input-file-format--result"></a>

#### Example of mode 1:

inputs the sRNA sequence in **FASTA format**

```
>miR166
UGAAGCUGCCAGCAUGAUCUA
>miR156
UGACAGAAGAGAGGGAGCAU
```

The result returns a list of target gene predictions, including sRNA, target Gene ID, targeted start position and end position, penalty, sRNA sequence and target site sequence.

<figure><img src="/files/EPFpPBvfBjTDolx8kac8" alt=""><figcaption></figcaption></figure>

#### Example of mode 2:

**inputs the gene sequence in FASTA format** or directly input the **Gene ID** (Take litchi as an example. If it is other Sapindaceae species, please input the corresponding gene ID format.)

```
>LITCHI020533
ATGACAAAGACAATCGAAAAAGAAAAAGAAAGTGAATACAAGAAAGGTTTATGGACTGTG
GAAGAAGACAAGCTACTTTCGGATTATGTACAAGTGCATGGCAAAGGACAATGGAATCGT
CTTGCCAAAAAAACAGGTTTGAAGAGATGTGGGAAAAGTTGTAGGTTAAGGTGGATGAAT
TATCTGAGTCCAAGTGTGAACAGAAGTAATTTCACTAAAGAAGAAGAAGATCTCATTATT
AGACTCCATAAGCTCCTTGGAAACAGATGGTCTTTGATTGCAAAACGAGTACCGGGACGA
ACCGACAATCAAGTGAAGAATTACTGGAACACTCATTTGAGCAAAAAGCTGGGAATCAAA
GATCAAACTCGCAGCGTTGGCGTGCTCTTGAACTCCGGCAAAGTATATGTGTCTGAGACT
AGTGTCACAGAAACATGTACCGCTTGTGATAAAAACATAAGTAGTGCAGCCACTCATATT
TTAACGGACCACAAAAGCAGCCAGAAAGCTGTGAATGTCTCGGACACACAAGATTCCATT
ATGGATGAAGGTTTCTTCAACTCCTTATGGGTGTCTGATGATGACTTGATGGAGTTTATG
GACGGTTATTCTTTAATTTGA
```

or input Gene ID

```
LITCHI020533
```

The result returns a list of prediction results of sRNA target sites in the input gene, including sRNA, target Gene ID, targeted start position and end position, penalty, sRNA sequence and target site sequence.

<figure><img src="/files/q55mgZsPJgOhorVs6ISK" alt=""><figcaption></figcaption></figure>


---

# Agent Instructions: Querying This Documentation

If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter:

```
GET https://jiawei-li.gitbook.io/sapbase-user-guide/analysis/srna-target-prediction.md?ask=<question>
```

The question should be specific, self-contained, and written in natural language.
The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.